The Weekly Challenge

10. TASK #2: Ethiopian Multiplication

HEADLINES

Today is the first monday of the month and time to declare the champion of last month. With great pleasure, we announce Simon Green as the Champion. Simon joined the Team PWC in the week 68. As of today, he has contributed 41 Perl solutions with 20 blogs.

We have two new members joining the team this week. Clifton Wood and Joel Crosswhite.

Lubos Kolouch shared fun blog themed on Advent Calendar. I would have made it to our own Advent Calendar if it was about one of the tasks associated with the weekly challenge. So what, we can still have fun. Thanks Lubos for sharing.

Contributions Summary

This week, we had 57 contributions by guests in 36 different languages. This is the best week as far as the guest contributions are concerned. Credit goes to two very reputed members of Team PWC, i.e. Abigail and Andrew Shitov. Honestly I was expecting this from Andrew but Abigail really surprised me. Proud to have super genous brain in our team. You can’t ignore other consistent contributors. It would be unfair if I take names here. I would like to THANK each and every guest contributors.

Languages Summary

While we are talking about contributions, lets share some interesting stats from the GitHub repository.

1) Commits: 12,074 (+248)

2) Pull Requests: 2,929 (+52)

3) Contributors: 149 (+2)

4) Fork: 188 (+2)

5) Stars: 85 (+1)

Last but not the least, I would like to thank each and every member for their support and encouragement.

ADVENT CALENDAR

Finally we started our own Advent Calendar 2020. I wasn’t sure initially because of the daily nature of it. Although I am behind the schedule but I am glad that I took the initiative.

Day 1: Octal Number System / Balanced Brackets by Jaldhar H. Vyas.

Day 2: Make it $200 by Ryan Thompson.

Day 3: LRU Cache by E. Choroba.

Day 4: GCD Sum by Andrew Shitov.

RECAP

Quick recap of the “The Weekly Challenge - 089” by Mohammad S Anwar.

PERL REVIEW

If you missed any past reviews then please checkout the collection.

RAKU REVIEW

If you missed any past reviews then please checkout the collection.

CHART

Please take a look at the charts showing interesting data.

I would like to THANK every member of the team for their valuable suggestions. Please do share your experience with us.

NEW MEMBERS

1) Clifton Wood from Washington, DC.

2) Joel Crosswhite.

Aaron Smith shared his detail with us:

I am a Data Engineer based in Austin, TX, USA. I come from a Python background, but my current gig is 100% Scala. My dive into the Perl world happened in grad school and into the beginning of my career when I worked in the Bioinformatics field (largely using BioPerl). More recently, my preferred Perl-family language is Raku, and I have been using it for pet projects for about the last 3 years.

Please find out How to contribute?, if you have any doubts.

Please give it a try to an excellent tool EZPWC created by respected member Saif Ahmed of Team PWC.

GUESTS

1) Abigail shared solution to Task #2 in Awk.

2) Abigail shared solution to Task #2 in Bash.

3) Abigail shared solution to Task #2 in Basic.

4) Abigail shared solution to Task #2 in Bc.

5) Abigail shared solution to Task #2 in Befunge.

6) Abigail shared solution to Task #2 in Brainfuck.

7) Abigail shared solution to Task #2 in C.

8) Abigail shared solution to Task #2 in Chef.

9) Abigail shared solution to Task #2 in Cobol.

10) Abigail shared solution to Task #2 in C Shell.

11) Abigail shared solution to Task #2 in Forth.

12) Abigail shared solution to Task #2 in Fortran.

13) Abigail shared solution to Task #2 in Mumps.

14) Abigail shared solution to Task #2 in Node.

15) Abigail shared solution to Task #2 in Ook.

16) Abigail shared solution to Task #2 in Pascal.

17) Abigail shared solution to Task #2 in Python.

18) Abigail shared solution to Task #2 in Ruby.

19) Abigail shared solution to Task #2 in SQL.

20) Adam Russell shared solutions to Task #1 and Task #2 in Prolog.

21) Andrew Shitov shared solution to Task #1 in Bash.

22) Andrew Shitov shared solution to Task #1 in C.

23) Andrew Shitov shared solution to Task #1 in C++.

24) Andrew Shitov shared solution to Task #1 in C#.

25) Andrew Shitov shared solution to Task #1 in D.

26) Andrew Shitov shared solution to Task #1 in Dart.

27) Andrew Shitov shared solution to Task #1 in Fortran.

28) Andrew Shitov shared solution to Task #1 in Go.

29) Andrew Shitov shared solution to Task #1 in Java.

30) Andrew Shitov shared solution to Task #1 in JavaScript.

31) Andrew Shitov shared solution to Task #1 in Julia.

32) Andrew Shitov shared solution to Task #1 in Kotlin.

33) Andrew Shitov shared solution to Task #1 in Lisp.

34) Andrew Shitov shared solution to Task #1 in Lua.

35) Andrew Shitov shared solution to Task #1 in Pascal.

36) Andrew Shitov shared solution to Task #1 in PHP.

37) Andrew Shitov shared solution to Task #1 in Python.

38) Andrew Shitov shared solution to Task #1 in Ruby.

39) Andrew Shitov shared solution to Task #1 in Rust.

40) Andrew Shitov shared solution to Task #1 in Scala.

41) Henry Wong shared solutions to Task #1 and Task #2 in PHP.

42) Jan Krnavek shared solution to Task #1 in Scala.

43) Nuno Vieira shared solutions to Task #1 and Task #2 in JavaScript.

44) Roger Bell_West shared solutions to Task #1 and Task #2 in Python.

45) Roger Bell_West shared solutions to Task #1 and Task #2 in Ruby.

46) Roger Bell_West shared solutions to Task #1 and Task #2 in Rust.

47) Tyler Wardhaugh shared solutions to Task #1 and Task #2 in Clojure.

48) Ulrich Rieke shared solution to Task #2 in C++.

49) Ulrich Rieke shared solutions to Task #1 and Task #2 in Haskell.

Please find out past solutions by respected guests. Please do share your creative solutions in other languages.

TASK #1 › DNA Sequence

Submitted by: Mohammad S Anwar

DNA is a long, chainlike molecule which has two strands twisted into a double helix. The two strands are made up of simpler molecules called nucleotides. Each nucleotide is composed of one of the four nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).

You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.

Write a script to print nucleiobase count in the given DNA sequence. Also print the complementary sequence where Thymine (T) on one strand is always facing an adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and vice versa.

To get the complementary sequence use the following mapping:

T => A
A => T
G => C
C => G

TASK #2 › Ethiopian Multiplication

Submitted by: Mohammad S Anwar

You are given two positive numbers $A and $B.

Write a script to demonstrate Ethiopian Multiplication using the given numbers.

Last date to submit the solution 23:59 (UK Time) Sunday 13th December 2020.